Reporte secuencia de una cepa de babesia bigemina aislada en bovinos del municipio Girón, Azuay, Ecuador

Abstract

In this study, the ab1 files obtained from Sanger sequencing (forward and reverse) were used to perform sequence assembly and analysis. For this, the Staden Package software (version 2.0b10) was used, which consists of two programs: Pregap4 and Gap4. Pregap4 was responsible for quality analysis and data preparation, while Gap4 performed assembly, verification, read pair analysis, contig editing, and confidence calculation of the consensus sequence. BLASTn was used to identify possible homologs (Babesia bovis and B. bigemina). Sequence-based sequencing of the 18S gene of B. bigemina, using the oligonucleotides For: PIRO A (5’–TACCCAATCCTGACACACAGGG–3’) y PIRO B (5’–TTAAATACACGAATGCCCCCCCAAC–3’), which obtained a band of approximately 393 bp, revealed the nucleotic distribution of a strain designated as 4623Ba.bi_GIR-E, of B. bigemina. The product yielded a sequence of 369 bp (>H230420-007_C05_46_Oligo1.ab1) and 371 bp (>H230420-007_I07_46_Oligo2.ab1). B. bigemina was isolated from the peripheral blood of infected crossbred cattle, positive for Giemsa smear, PCR-RFLP and qRT-PCR, from the Municipality of Girón in the Province of Azuay, Ecuador, located at greather than 2,000 meters above sea level, which shares high homology, greather than 98 %, with several sequences of B. bigemina reported in Ecuador, Latin American Countries such as Colombia, Brazil, revealing possible origins of the pathogen and, with the sequences of B. bigemina published isolated in extra-continental latitudes, thus corroborating the genomic stability of the parasite.